Anti-CCNI2 Antibody

Find now the highest quality Anti-CCNI2 Antibody suitable for your research. Gentaur Genprice provides the best Anti-CCNI2 Antibodies from trusted manufacturers.

1-CSB-PA004824GA01HU
CCNI2 Antibody
Cusabio
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
  • 150ul
  • 50ul
Description: A polyclonal antibody against CCNI2. Recognizes CCNI2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
20-abx910840
CCNI2 siRNA
Abbexa
  • Shipped within 5-10 working days.
  • 15 nmol
  • 30 nmol
Cyclin I2 (CCNI2) Antibody
abx026494-400ul
Abbexa
  • Shipped within 5-10 working days.
400 μl
Cyclin I2 (CCNI2) Antibody
abx026494-80l
Abbexa
  • Shipped within 5-10 working days.
80 µl
20-abx116795
Cyclin I2 (CCNI2) Antibody
Abbexa
  • Shipped within 5-10 working days.
  • 150 μl
  • 50 μl
Cyclin I2 (CCNI2) Antibody
abx231384-100ug
Abbexa
  • Shipped within 5-12 working days.
100 μg
CCNI2 cloning plasmid
CSB-CL765058HU-10ug
Cusabio
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1110
  • Sequence: atggcctcgggcgctcagctcccgccgcagccgtcgagctcagaggtcagcgccgtccagagcccaggcgggcgtcccggcgccggtctggaggaaacagccctgggcgttcctctcccgccgtctccgggggaggcccctctgccccgaagcaaccggagcaggtgccctggga
  • Show more
10ug
Description: A cloning plasmid for the CCNI2 gene.
20-abx968504
Human CCNI2 shRNA Plasmid
Abbexa
  • Shipped within 15-20 working days.
  • 150 µg
  • 300 µg
CCNI2 Recombinant Protein (Human)
RP037855
ABM 100 ug
CCNI2 ORF Vector (Human) (pORF)
ORF012619
ABM 1.0 ug DNA

Related Products

These Anti-DSG4 Antibodies are tested by the research teams of Saint Michael’s College and Brigham Young University-Idaho

want a datasheet ?

want A Quote ?