Loading cart contents...
MB cloning plasmid
Seller Gentaur · Catalog number: CSB-CL013529HU1-10ug
(0) Reviews
Availability:
Made to order
Price
0.01 USD*
Size
10ug
* Net price, excluding transport costs. Contact us to receive the current offer within 24 hours.
Ask for price
Availability: Out of stock
Cat: CSB-CL013529HU2-10ug
Ask for more info: [email protected]
Ask for price
Availability: Out of stock
Cat: CSB-CL003995HU1-10ug
Ask for more info: [email protected]
Ask for price
Availability: Out of stock
Cat: CSB-CL004036HU-10ug
Ask for more info: [email protected]
Ask for price
Availability: Out of stock
Cat: CSB-CL003995HU2-10ug
Ask for more info: [email protected]
Ask for price
Availability: Out of stock
Cat: CSB-CL006031HU1-10ug
Ask for more info: [email protected]
-
Specifications:
- Gene name: MB
- Gene ID: 4151
- Accession number: BC014547
- Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
- Storage and shipping: Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
- Notes: For research use only.
-
Additional information:
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 465
- Sequence: atggggctcagcgacggggaatggcagttggtgctgaacgtctgggggaaggtggaggctgacatcccaggccatgggcaggaagtcctcatcaggctctttaagggtcacccagagactctggagaagtttgacaagttcaagcacctgaagtcagaggacgagatgaaggcatctgaggacttaaagaagcatggtgccactgtgctcaccgccctgggtggcatccttaagaagaaggggcatcatgaggcagagattaagcccctggcacagtcgcatgccaccaagcacaagatccccgtgaagtacctggagttcatctcggaatgcatcatccaggttctgcagagcaagcatcccggggactttggtgctgatgcccagggggccatgaacaaggccctggagctgttccggaaggacatggcctccaactacaaggagctgggcttccagggctag