Recent Posts.

(408)780-0908 [email protected]
…
Loading cart contents...
  • Product >
  • Business and Industry >
  • Scientific and Laboratory Research >
  • Cusabio >
  • PTGIR cloning plasmid
PTGIR cloning plasmid

PTGIR cloning plasmid

Seller Gentaur · Catalog number: CSB-CL018981HU-10ug

Category product: Business and Industry > Scientific and Laboratory Research

 (0) Reviews
Availability: Made to order
Price

0.01 USD*

Size
10ug
PTGIR cloning plasmid
PTGIR cloning plasmid

Catalog number: / Size: / Price : USDtest product-price-currency (VAT free)

Go to cart Go to order
Inquiry cart
1
Adres Email: | Edit
2
Details of the inquiry
PTGIR cloning plasmid
PTGIR cloning plasmid

Catalog number: CSB-CL018981HU-10ug / Size: 10ug / Price: 0.01 USD (VAT free)

3
Inquiry cart
* Net price, excluding transport costs. Contact us to receive the current offer within 24 hours.
PTGDS cloning plasmid
Ask for price
PTGDS cloning plasmid
Availability: Out of stock
Cat: CSB-CL018969HU-10ug
Ask for more info: [email protected]
PTGES cloning plasmid
Ask for price
PTGES cloning plasmid
Availability: Out of stock
Cat: CSB-CL018976HU-10ug
Ask for more info: [email protected]
PTGR2 cloning plasmid
Ask for price
PTGR2 cloning plasmid
Availability: Out of stock
Cat: CSB-CL018984HU-10ug
Ask for more info: [email protected]
Rat PTGIR shRNA Plasmid
Ask for price, Ask for price
Rat PTGIR shRNA Plasmid
Availability: InStockInStock
Cat: 20-abx988569
Ask for more info: [email protected]
GC cloning plasmid
Ask for price
GC cloning plasmid
Availability: Out of stock
Cat: CSB-CL009306HU-10ug
Ask for more info: [email protected]
  • Details
  • Specifications:
    • Gene name: PTGIR
    • Gene ID: 5739
    • Accession number: BC075814
    • Vector: pUC
  • Storage and shipping: Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes: For research use only.
  • Additional information:
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1161
    • Sequence: atggcggattcgtgcaggaacctcacctacgtgcggggctcggtggggccggccaccagcaccctgatgttcgtggccggtgtggtgggcaacgggctggccctgggcatcctgagcgcacggcgaccggcgcgcccctcggccttcgcggtgctggtcaccggactggcggccaccgacctgctgggcaccagcttcctgagcccggccgtgttcgtggcctatgcgcgcaacagctccctgctgggcctggcccgaggcggccccgccctgtgcgatgccttcgccttcgccatgaccttcttcggcctggcgtccatgctcatcctctttgccatggccgtggagcgctgcctggcgctgagccacccctacctctacgcgcagctggacgggccccgctgcgcccgcctggcgctgccagccatctacgccttctgcgtcctcttctgcgcgctgcccctgctgggcctgggccaacaccagcagtactgccccggcagctggtgcttcctccgcatgcgctgggcccagccgggcggcgccgccttctcgctggcctacgccggcctggtggccctgctggtggctgccatcttcctctgcaacggctcggtcaccctcagcctctgccgcatgtaccgccagcagaagcgccaccagggctctctgggtccacggccgcgcaccggagaggacgaggtggaccacctgatcctgctggccctcatgacagtggtcatggccgtgtgctccctgcctctcacgatccgctgcttcacccaggctgtcgcccctgacagcagcagtgagatgggggacctccttgccttccgcttctacgccttcaaccccatcctggacccctgggtcttcatccttttccgcaaggctgtcttccagcgactcaagctctgggtctgctgcctgtgcctcgggcctgcccacggagactcgcagacacccctttcccagctcgcctccgggaggagggacccaagggccccctctgctcctgtgggaaaggaggggagctgcgtgcctttgtcggcttggggcgaggggcaggtggagcccttgcctcccacacagcagtccagcggcagcgccgtgggaacgtcgtccaaagcagaagccagcgtcgcctgctccctctgctga